Summary of this 90AA cluster, including consensus sequences, ecological annotation, quality evidence, and linked 100AA members.
This is a 90AA family-level cluster. In GMSC, 90AA and 100AA refer to catalogue identity thresholds rather than sequence length: 90AA groups related smORFs at 90% amino acid identity, while 100AA accessions are non-redundant sequence entries.
The linked 100AA members let you inspect the individual non-redundant sequences assigned to this family, while the taxonomy and habitat summarise the ecological context of the cluster.
Representative protein sequence (98 amino acids)
Legend
Consensus nucleotide sequence
ATGATTGCAATTTTTTATTTGGTTCTACAAATACTTAAACTTTACTCATATGTCGTTATAGCAAATGTAATAATAAGTTGGTTGATTGCATTTAATATTTTGAATACACAAAATAGGTTTGTTTATTCAATTTTAGAGTTTACCTATCGTCTTACAGACCCAATTTTAAATAAAATTAGACGTTTTTTACCCAATTTAGGTTCTTTAGATATTTCTCCAATCATTTTACTTTTATTGATTTGGTTTATAGAAATGTGTATGAAGCTTTACATTGCACCTATAATTTTTAAATTATGA
Taxonomic assignment
Habitat
coral associated,crustacean gut,isolate,marine,river associated,soil,water associated
Review the detailed quality checks below to understand the evidence supporting this cluster.
Load the 100AA non-redundant smORF accessions assigned to this 90AA family to inspect their sequences, habitats, and taxonomy.