Summary of this 90AA cluster, including consensus sequences, ecological annotation, quality evidence, and linked 100AA members.
This is a 90AA family-level cluster. In GMSC, 90AA and 100AA refer to catalogue identity thresholds rather than sequence length: 90AA groups related smORFs at 90% amino acid identity, while 100AA accessions are non-redundant sequence entries.
The linked 100AA members let you inspect the individual non-redundant sequences assigned to this family, while the taxonomy and habitat summarise the ecological context of the cluster.
Representative protein sequence (99 amino acids)
Legend
Consensus nucleotide sequence
ATGGCTGTGCTGAAACTGATGCTGAAACTTGCCCTTCTCCCGTTGCTTCTGCTGCTGATTCTGGCGCAGTGGGTGGGCATCTTCCTCACGACCTTCTCCACGATCCTGACGAATCTGCTGGCGGGACTGTTCTTCTTCGTGGCTCTGGCAAGCTGGGTCATGAAGCTGGCAGACGGCGGCGAAGTCCTGAAAATGCTGATTACCGCATTTGTGGTTTTCGTCCTACCTTACATAGCGATAGCTGCTATCGCAAAAATCTCCTTTTTCGCTGAGGAACTCCGGGATTTTCTCCAATCCTGA
Taxonomic assignment
Habitat
activated sludge,cat gut,cattle gut,chicken gut,dog gut,human gut,human skin,isolate,pig gut,primate gut,wastewater
Review the detailed quality checks below to understand the evidence supporting this cluster.
Load the 100AA non-redundant smORF accessions assigned to this 90AA family to inspect their sequences, habitats, and taxonomy.